Review





Similar Products

94
Proteintech oligo2
Oligo2, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/OLIG2+Fusion+Protein/pm41572572-110-165-170
Average 94 stars, based on 1 article reviews
oligo2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
Thermo Fisher oligo1 atcaatatccacctgcagattctaccaaaagtgtatttggaaactgctccatcaaaaggcatgttcagctg oligo2
Oligo1 Atcaatatccacctgcagattctaccaaaagtgtatttggaaactgctccatcaaaaggcatgttcagctg Oligo2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/Phosphate/pmc12606344-193-0-36
Average 99 stars, based on 1 article reviews
oligo1 atcaatatccacctgcagattctaccaaaagtgtatttggaaactgctccatcaaaaggcatgttcagctg oligo2 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
Millipore rabbit-anti oligo2
Rabbit Anti Oligo2, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/rabbit+anti+olig2/10__4103_slash_nrr__nrr___d___24___01112-122-54-56
Average 90 stars, based on 1 article reviews
rabbit-anti oligo2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher rabbit anti-oligo2
Rabbit Anti Oligo2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/oligo++2/10__4103_slash_nrr__nrr___d___24___00435-113-0-6
Average 90 stars, based on 1 article reviews
rabbit anti-oligo2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
baseclick GmbH oligo2-click kit l
Oligo2 Click Kit L, supplied by baseclick GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/oligo2+click+kit+l/us12209243-225-22-23
Average 90 stars, based on 1 article reviews
oligo2-click kit l - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GeneTex anti-oligodendrocyte lineage transcription factor 2 (oligo2
Anti Oligodendrocyte Lineage Transcription Factor 2 (Oligo2, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/primary+antibodies+oligo2/pm39424023-107-28-34
Average 90 stars, based on 1 article reviews
anti-oligodendrocyte lineage transcription factor 2 (oligo2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
Proteintech anti oligo2
Anti Oligo2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligo2/OLIG2+Antibody/pmc11255228-260-33-42
Average 96 stars, based on 1 article reviews
anti oligo2 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results